Top » Catalog » SNPs » S3003

$18.00

S3003
[S3003]

S3003
hg38 Position: ChrY:16010211..16010211
Ancestral: C
Derived: T
Reference: Jim Wilson (2014)
ISOGG Haplogroup: E (not listed)
Comments: .
Forward Primer: S3003_F TGATTTAGTGTTGTGTGGGTGC
Reverse Primer: S3003_R TCTCCTCTGCAATGACTCTCAC
Reviews

Customers who bought this product also purchased
BY6279
BY6279
BY6338
BY6338
BY153006
BY153006
BY6527
BY6527
BY4518
BY4518
Z17264
Z17264
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies