Top » Catalog » SNPs » BY162742

$18.00

BY162742
[BY162742]

BY162742
hg38 Position: ChrY:17164904..17164904
Ancestral: T
Derived: A
Reference: FTDNA (2018)
ISOGG Haplogroup: J2b
Comments: .
Forward Primer: BY162742_F CTATATTTGGTTGTTTTTGTGATTATGTAC
Reverse Primer: BY162742_R GTCAGTAGAACATTCCATTTTTCAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies