Top » Catalog » SNPs » FT206787

$18.00

FT206787
[FT206787]

FT206787
hg38 Position: ChrY:7409548..7409548
Ancestral: A
Derived: G
Reference: FTDNA (2019)
ISOGG Haplogroup: R1a
Comments: Below M458 > L1029 > YP1137
Forward Primer: FT206787_F GTCTCTGATAAAACACACTTTAAAACAAC
Reverse Primer: FT206787_R CACCACACCCGGCTGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies