Top » Catalog » SNPs » Y205716

$18.00

Y205716
[Y205716]

Y205716
hg38 Position: ChrY:17335880..17335880
Ancestral: T
Derived: G
Reference: YFull (2020)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: Y205716_F CTACCGTGGCCAATATGGAG
Reverse Primer: Y205716_R GATTTCCATGACACTTTCAGACC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies