Top » Catalog » SNPs » Y205991

$18.00

Y205991
[Y205991]

Y205991
hg38 Position: ChrY:19014864..19014864
Ancestral: T
Derived: C
Reference: YFull (2020)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: Y205991_F GTCCAGACATGTATGTGTGCG
Reverse Primer: Y205991_R TTCGCTCTTGTCGCCTAGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies