Top » Catalog » SNPs » BY168164

$18.00

BY168164
[BY168164]

BY168164
hg38 Position: ChrY:17426320..17426320
Ancestral: T
Derived: C
Reference: FTDNA (2018)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: BY168164_F TCTTCTTGCCTGCAGACTAAATTAG
Reverse Primer: BY168164_R AGAATTGCAATACAGAAAGAGAACC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies