Top » Catalog » SNPs » BY226145

$18.00

BY226145
[BY226145]

BY226145
hg38 Position: ChrY:22726959..22726959
Ancestral: A
Derived: C
Reference: FTDNA (2019)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: BY226145_F CCCAAAATAAGTTTATATCAAATCCG
Reverse Primer: BY226145_R GGTTCTGTTATAAAGGCAAAGTAACAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies