Top » Catalog » SNPs » BY166383

$18.00

BY166383
[BY166383]

BY166383
hg38 Position: ChrY:8548958..8548958
Ancestral: G
Derived: C
Reference: FTDNA (2018)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: BY166383_F TCTGCTTAGGCAGGCTGAAG
Reverse Primer: BY166383_R ACACTGGCAACTCTCCCATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies