Top » Catalog » SNPs » ZS9639

$18.00

ZS9639
[ZS9639]

ZS9639
hg38 Position: ChrY:15092355..15092355
Ancestral: T
Derived: C
Reference: Victar Mas (2015)
ISOGG Haplogroup: J1
Comments: downstream BY145
Forward Primer: ZS9639_F TATTCTTGTGAATAGTTTCTCATTATCATG
Reverse Primer: ZS9639_R CAGCTTACTGCAACCTTTGACTCCCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x DYS458
$11.00
Haplogroup Info
Other products
Currencies