Top » Catalog » SNPs » FGC83207

$18.00

FGC83207
[FGC83207]

FGC83207
hg38 Position: ChrY:10786658..10786658
Ancestral: C
Derived: A
Reference: Full Genomes Corp. (2018)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC83207_F CCAGGCTGGAGTGCTGTC
Reverse Primer: FGC83207_R ATAGGAACTAAATGGAATGTAGTGATTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies