Top » Catalog » SNPs » BY107094

$18.00

BY107094
[BY107094]

BY107094
hg38 Position: ChrY:14231671..14231671
Ancestral: A
Derived: G
Reference: FTDNA (2018)
ISOGG Haplogroup: E1b
Comments: Below M35 > Z830 > Y139639
Forward Primer: BY107094_F TCATTACAACTGGAACACTGTGTTC
Reverse Primer: BY107094_R CCACTACCGCCCTATTGAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x DYS552
$9.95
Haplogroup Info
Other products
Currencies