Top » Catalog » SNPs » rs11385942

$18.00

rs11385942
[rs11385942]

rs11385942
hg38 Position: Chr3:45834968..45834969
Ancestral: del
Derived: ins
Reference: dbSNP
ISOGG Haplogroup: none
Comments: LZTFL1 Intron Variant. Research only! Not for diagnostic procedures.
Forward Primer: rs11385942_F GAAAAAGAGTACCACAAATTCCTAGG
Reverse Primer: rs11385942_R TTATGAAATTGCTTTTCAGGCTATC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC2
$18.00
Haplogroup Info
Other products
Currencies