Top » Catalog » SNPs » A27198

$18.00

A27198
[A27198]

A27198
hg38 Position: ChrY:13364647..13364647
Ancestral: T
Derived: A
Reference: YSEQ (2020)
ISOGG Haplogroup: J1
Comments: Below FGC11 > FGC4
Forward Primer: A27198_F GATTTTGGCTCACTGCGG
Reverse Primer: A27198_R GGTAACCCAGACATTTTTTCTCC
Reviews

Customers who bought this product also purchased
FGC5
FGC5
FGC11
FGC11
FGC7
FGC7
J1-M267 Superclade Panel
J1-M267 Superclade Panel
FGC1696
FGC1696
HU368
HU368
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies