Top » Catalog » SNPs » A27198

$19.00

A27198
[A27198]

A27198
hg38 Position: ChrY:13364647..13364647
Ancestral: T
Derived: A
Reference: YSEQ (2020)
ISOGG Haplogroup: J1
Comments: Below FGC11 > FGC4
Forward Primer: A27198_F GATTTTGGCTCACTGCGG
Reverse Primer: A27198_R GGTAACCCAGACATTTTTTCTCC
Reviews

Customers who bought this product also purchased
A27206
A27206
Y33888
Y33888
FT109263
FT109263
Y368170
Y368170
FGC4290
FGC4290
ZS5010
ZS5010
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies