Top » Catalog » SNPs » A27207

$19.00

A27207
[A27207]

A27207
hg38 Position: ChrY:19851238..19851238
Ancestral: T
Derived: C
Reference: YSEQ (2020)
ISOGG Haplogroup: J1
Comments: Below FGC11 > FGC4
Forward Primer: A27207_F CCTGCAGCTGAAGATACTGTCTC
Reverse Primer: A27207_R TTCTTGGAGGCTTTGTTCATG
Reviews

Customers who bought this product also purchased
ZS10638
ZS10638
BY4
BY4
Y337898
Y337898
BY145
BY145
HU683
HU683
ALK391
ALK391
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies