Top » Catalog » SNPs » A27207

$19.00

A27207
[A27207]

A27207
hg38 Position: ChrY:19851238..19851238
Ancestral: T
Derived: C
Reference: YSEQ (2020)
ISOGG Haplogroup: J1
Comments: Below FGC11 > FGC4
Forward Primer: A27207_F CCTGCAGCTGAAGATACTGTCTC
Reverse Primer: A27207_R TTCTTGGAGGCTTTGTTCATG
Reviews

Customers who bought this product also purchased
FGC5427
FGC5427
Y33889
Y33889
Y200867
Y200867
J1-FGC5 Panel
J1-FGC5 Panel
Y198994
Y198994
FGC5441
FGC5441
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies