Top » Catalog » SNPs » A27191

$18.00

A27191
[A27191]

A27191
hg38 Position: ChrY:21285615..21285615
Ancestral: C
Derived: A
Reference: YSEQ (2020)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: A27191_F TGTAGGGTACTTCTCAAAAAAATACTGG
Reverse Primer: A27191_R TCTTATTATTTTGAGATATGTCCCATCAC
Reviews

Customers who bought this product also purchased
FGC1696
FGC1696
FGC1695
FGC1695
L858
L858
FGC48131
FGC48131
FGC4453
FGC4453
FGC1713
FGC1713
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies