Top » Catalog » SNPs » A27663

$18.00

A27663
[A27663]

A27663
hg38 Position: ChrY:6847512..6847512
Ancestral: A
Derived: G
Reference: Salim (2020)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: A27663vl3_F TGAGTGTCCCAATTTTGTGC
Reverse Primer: A27663vl3_R GCCAGAGCACACTGAGTGAG
Reviews

Customers who bought this product also purchased
A27840
A27840
A27845
A27845
A27662
A27662
A27844
A27844
J1 Taalba Panel
J1 Taalba Panel
A27843
A27843
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies