Top » Catalog » SNPs » A27663



hg38 Position: ChrY:6847512..6847512
Ancestral: A
Derived: G
Reference: Salim (2020)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: A27663vl3_F TGAGTGTCCCAATTTTGTGC
Reverse Primer: A27663vl3_R GCCAGAGCACACTGAGTGAG

Customers who bought this product also purchased
J1 Taalba Panel
J1 Taalba Panel
Quick Find
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products