Top » Catalog » SNPs » S6881

$18.00

S6881
[S6881]

S6881
hg38 Position: ChrY:7305814..7305814
Ancestral: G
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a1a2a1a1c2b2a1b1a4b1c1
Comments: .
Forward Primer: S6881_F TAGACCCAACATGGCCTGAG
Reverse Primer: S6881_R TGCAGGAATCCACCTTATCTG
Reviews

Customers who bought this product also purchased
DF13
DF13
M410
M410
Prepaid Return Envelope
Prepaid Return Envelope
MZ7
MZ7
FGC11780
FGC11780
DNA Sample Kit
DNA Sample Kit
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies