Top » Catalog » SNPs » Z383

$18.00

Z383
[Z383]

Z383
hg38 Position: ChrY:22259715..22259715
Ancestral: C
Derived: T
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1b1a1a2a1a2b1a1~
Comments: approx. with R-L20
Forward Primer: Z383_F AGGCATAATGAGAAAGGTGTGG
Reverse Primer: Z383_R AAGTAGGGCTTTTTATCTGTGTGC
Reviews

Customers who bought this product also purchased
R1b-L48 Panel
R1b-L48 Panel
*TOP* - Top-Level Orientation SNP Panel
*TOP* - Top-Level Orientation SNP Panel
S268
S268
P312
P312
Y13229
Y13229
Z18
Z18
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies