Top » Catalog » SNPs » Z383

$18.00

Z383
[Z383]

Z383
hg38 Position: ChrY:22259715..22259715
Ancestral: C
Derived: T
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1b1a1a2a1a2b1a1~
Comments: approx. with R-L20
Forward Primer: Z383_F AGGCATAATGAGAAAGGTGTGG
Reverse Primer: Z383_R AAGTAGGGCTTTTTATCTGTGTGC
Reviews

Customers who bought this product also purchased
Z18
Z18
S170
S170
M343
M343
FGC8563
FGC8563
L48
L48
S515
S515
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies