Top » Catalog » SNPs » Z383

$18.00

Z383
[Z383]

Z383
hg38 Position: ChrY:22259715..22259715
Ancestral: C
Derived: T
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1b1a1a2a1a2b1a1~
Comments: approx. with R-L20
Forward Primer: Z383_F AGGCATAATGAGAAAGGTGTGG
Reverse Primer: Z383_R AAGTAGGGCTTTTTATCTGTGTGC
Reviews

Customers who bought this product also purchased
S515
S515
L145
L145
FGC8604
FGC8604
DF96
DF96
S511
S511
P38
P38
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies