Top » Catalog » SNPs » Y190063

$18.00

Y190063
[Y190063]

Y190063
hg38 Position: ChrY:12185085..12185085
Ancestral: T
Derived: A
Reference: YFull (2018)
ISOGG Haplogroup: I2
Comments: Below PH908 > FT14506 > Y56203
Forward Primer: Y190063_F ATATGATAATCTCAATAGATGCAGGAAG
Reverse Primer: Y190063_R CATTTGTTTGTATCCTCTCTTATTTTG
Reviews

Customers who bought this product also purchased
Y190064
Y190064
Y134622
Y134622
Y61610
Y61610
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies