Top » Catalog » SNPs » Y190063

$18.00

Y190063
[Y190063]

Y190063
hg38 Position: ChrY:12185085..12185085
Ancestral: T
Derived: A
Reference: YFull (2018)
ISOGG Haplogroup: I2
Comments: Below PH908 > FT14506 > Y56203
Forward Primer: Y190063_F ATATGATAATCTCAATAGATGCAGGAAG
Reverse Primer: Y190063_R CATTTGTTTGTATCCTCTCTTATTTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies