Top » Catalog » SNPs » FGC3910

$19.00

FGC3910
[FGC3910]

FGC3910
hg38 Position: ChrY:7505366..7505366
Ancestral: C
Derived: G
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: R1b
Comments: Below DF21 > DF5 > FGC3911
Forward Primer: FGC3910_F GACGGAGTCTCGTTCTGTCG
Reverse Primer: FGC3910_R TTTAACTACCTTATCAGCATAAGCATTC
Reviews

Customers who bought this product also purchased
FGC3915
FGC3915
FGC3928
FGC3928
R1b-L626 Segregation Panel
R1b-L626 Segregation Panel
FGC3927
FGC3927
FGC3925
FGC3925
FGC3939
FGC3939
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies