Top » Catalog » SNPs » A27840

$18.00

A27840
[A27840]

A27840
hg38 Position: ChrY:14802921..14802921
Ancestral: A
Derived: C
Reference: Elfatih Salim (2020)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: A27840v2_F CTGAACTTGAGACTGTTGCAGTG
Reverse Primer: A27840v2_R AGACATGTCAAACAAGATCATATATGG
Reviews

Customers who bought this product also purchased
A27842
A27842
A27841
A27841
A27663
A27663
A27845
A27845
A27662
A27662
A27844
A27844
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies