Top » Catalog » SNPs » A27844

$18.00

A27844
[A27844]

A27844
hg38 Position: ChrY:21162160..21162160
Ancestral: A
Derived: G
Reference: Elfatih Salim (2020)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: A27844_F CTAGCTTTCAAAGGAAGAGGGTAC
Reverse Primer: A27844_R AATGCCCTGAATGGGAAGAC
Reviews

Customers who bought this product also purchased
A27841
A27841
A27840
A27840
A27663
A27663
A27845
A27845
A27662
A27662
A27843
A27843
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies