Top » Catalog » SNPs » Y22558

$18.00

Y22558
[Y22558]

Y22558
hg38 Position: ChrY:7290981..7290992
Ancestral: ins
Derived: del
Reference: YFull (2016)
ISOGG Haplogroup: E1b
Comments: Below M81 > PF6789
Forward Primer: Y22558_F CCACCTGATTTTGGTGTTTCAC
Reverse Primer: Y22558_R AACCCAGGAGGTGGATGG
Reviews

Customers who bought this product also purchased
MZ99
MZ99
L335
L335
M267
M267
M96
M96
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
M5043
M5043
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies