Top » Catalog » SNPs » Y22558

$18.00

Y22558
[Y22558]

Y22558
hg38 Position: ChrY:7290981..7290992
Ancestral: ins
Derived: del
Reference: YFull (2016)
ISOGG Haplogroup: E1b
Comments: Below M81 > PF6789
Forward Primer: Y22558_F CCACCTGATTTTGGTGTTTCAC
Reverse Primer: Y22558_R AACCCAGGAGGTGGATGG
Reviews

Customers who bought this product also purchased
M5343
M5343
Y109169
Y109169
MZ99
MZ99
CTS6185
CTS6185
BY198035
BY198035
MF4289
MF4289
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies