Top » Catalog » SNPs » CTS6739

$18.00

CTS6739
[CTS6739]

CTS6739
hg38 Position: ChrY:14974415..14974415
Ancestral: T
Derived: C
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: I1a2a1a1a1 (not listed)
Comments: Extracted from 1000 genomes data. Not qualified.
Forward Primer: CTS6739_F TTACAGGTGAGAGCGACTGC
Reverse Primer: CTS6739_R TGAGTCCCATTTTTGCCTTC
Reviews

Customers who bought this product also purchased
BY178134
BY178134
F2642
F2642
FGC65549
FGC65549
S1953
S1953
BY477
BY477
Z141
Z141
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies