Top » Catalog » SNPs » CTS6772

$18.00

CTS6772
[CTS6772]

CTS6772
hg38 Position: ChrY:14988304..14988304
Ancestral: C
Derived: G
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: I1a2a1a1a1 (not listed)
Comments: Extracted from 1000 genomes data.
Forward Primer: CTS6772_F GCATACCTAAGTAAGGAAATTCACATAC
Reverse Primer: CTS6772_R TCCCAGTTCTAAGTCTGGAGTAAGTATC
Reviews

Customers who bought this product also purchased
A13959
A13959
CTS2291
CTS2291
A13951
A13951
Z138
Z138
DF29
DF29
A6452
A6452
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies