Top » Catalog » SNPs » FGC3944

$18.00

FGC3944
[FGC3944]

FGC3944
hg38 Position: ChrY:20965282..20965283
Ancestral: del
Derived: ins
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: R1b
Comments: Below DF21 > DF5 > FGC3911
Forward Primer: FGC3944_F CAATTAGGACGAAGAGACAATGAAG
Reverse Primer: FGC3944_R TCTTTCTGAATTAGTCTTGACAGGC
Reviews

Customers who bought this product also purchased
FGC3928
FGC3928
R1b-L626 Segregation Panel
R1b-L626 Segregation Panel
FGC3927
FGC3927
FGC3925
FGC3925
FGC3939
FGC3939
FGC3924
FGC3924
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies