Top » Catalog » SNPs » FGC3944

$18.00

FGC3944
[FGC3944]

FGC3944
hg38 Position: ChrY:20965282..20965283
Ancestral: del
Derived: ins
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: R1b
Comments: Below DF21 > DF5 > FGC3911
Forward Primer: FGC3944_F CAATTAGGACGAAGAGACAATGAAG
Reverse Primer: FGC3944_R TCTTTCTGAATTAGTCTTGACAGGC
Reviews

Customers who bought this product also purchased
FGC3925
FGC3925
FGC3939
FGC3939
FGC3924
FGC3924
FGC3937
FGC3937
FGC3923
FGC3923
FGC3932
FGC3932
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies