Top » Catalog » SNPs » Y141584

$18.00

Y141584
[Y141584]

Y141584
hg38 Position: ChrY:16573371..16573371
Ancestral: G
Derived: A
Reference: YFull (2018)
ISOGG Haplogroup: E1b
Comments: Below L19
Forward Primer: Y141584_F AAGAGGTTAAAACTTTCAGAGTAGGATG
Reverse Primer: Y141584_R GTGGGGTGGCTAGAGTCTTTC
Reviews

Customers who bought this product also purchased
PF6789
PF6789
MZ247
MZ247
MZ90
MZ90
BY10132
BY10132
Z5009
Z5009
MZ22
MZ22
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies