Top » Catalog » SNPs » Y141584

$18.00

Y141584
[Y141584]

Y141584
hg38 Position: ChrY:16573371..16573371
Ancestral: G
Derived: A
Reference: YFull (2018)
ISOGG Haplogroup: E1b
Comments: Below L19
Forward Primer: Y141584_F AAGAGGTTAAAACTTTCAGAGTAGGATG
Reverse Primer: Y141584_R GTGGGGTGGCTAGAGTCTTTC
Reviews

Customers who bought this product also purchased
Z5009
Z5009
MZ22
MZ22
PF2546
PF2546
MZ3
MZ3
Z21389
Z21389
E1b-L19 Panel
E1b-L19 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x HVR2
1 x mtUpgrade
$140.00
Haplogroup Info
Other products
Currencies