Top » Catalog » SNPs » Y141584

$18.00

Y141584
[Y141584]

Y141584
hg38 Position: ChrY:16573371..16573371
Ancestral: G
Derived: A
Reference: YFull (2018)
ISOGG Haplogroup: E1b
Comments: Below L19
Forward Primer: Y141584_F AAGAGGTTAAAACTTTCAGAGTAGGATG
Reverse Primer: Y141584_R GTGGGGTGGCTAGAGTCTTTC
Reviews

Customers who bought this product also purchased
BY10126
BY10126
Y183077
Y183077
FT234139
FT234139
M5043
M5043
A2227
A2227
M81
M81
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies