Top » Catalog » SNPs » BY9753

$18.00

BY9753
[BY9753]

BY9753
hg38 Position: ChrY:10045629..10045629
Ancestral: C
Derived: T
Reference: FTDNA (2016)
ISOGG Haplogroup: E1b
Comments: Below M81 > Z5009 > FT31300
Forward Primer: BY9753_F TGTTTCACACGACTAGCAAAAATC
Reverse Primer: BY9753_R AACATTCACCCCTAGACGCTC
Reviews

Customers who bought this product also purchased
MZ136
MZ136
FT201404
FT201404
E1b-L19 Panel
E1b-L19 Panel
Z5011
Z5011
FT76699
FT76699
A1152
A1152
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies