Top » Catalog » SNPs » S1990

$18.00

S1990
[S1990]

S1990
hg38 Position: ChrY:14576643..14576643
Ancestral: G
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: I1a2a1a1a1 (not listed)
Comments: .
Forward Primer: S1990_F TCTTCTGGTGTGCTGTTTGC
Reverse Primer: S1990_R CTTGCCCCATCTCAACTCTC
Reviews

Customers who bought this product also purchased
YSC0000260
YSC0000260
Y12990
Y12990
Y23905
Y23905
Y7521
Y7521
FGC74328
FGC74328
YSC0000261
YSC0000261
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies