Top » Catalog » SNPs » S21872

$18.00

S21872
[S21872]

S21872
hg38 Position: ChrY:17054624..17054624
Ancestral: C
Derived: T
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: DF13*
Forward Primer: S21872_F TGCTCAGGCTGATGTCTCTC
Reverse Primer: S21872_R TGGAAGCTAAACCTGTTAGACTG
Reviews

Customers who bought this product also purchased
FGC56425
FGC56425
Z2125
Z2125
FGC56440
FGC56440
Z2123
Z2123
S15948
S15948
F1345
F1345
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies