Top » Catalog » SNPs » Y6075

$18.00

Y6075
[Y6075]

Y6075
hg38 Position: ChrY:7543946..7543946
Ancestral: T
Derived: C
Reference: Yfull (2014)
ISOGG Haplogroup: N1c1a1a1a1a4a (not listed)
Comments: Aka Z17078. Below CTS8173
Forward Primer: Y6075_F TGTCAGAAGCAGTAGCAGCAG
Reverse Primer: Y6075_R CTTAGGGAAGCCACTTTCTTATTG
Reviews

Customers who bought this product also purchased
L550
L550
Z16980
Z16980
M2783
M2783
Y17242
Y17242
N1a-VL29 Panel
N1a-VL29 Panel
A11470
A11470
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies