Top » Catalog » SNPs » Y6075

$18.00

Y6075
[Y6075]

Y6075
hg38 Position: ChrY:7543946..7543946
Ancestral: T
Derived: C
Reference: Yfull (2014)
ISOGG Haplogroup: N1c1a1a1a1a4a (not listed)
Comments: Aka Z17078. Below CTS8173
Forward Primer: Y6075_F TGTCAGAAGCAGTAGCAGCAG
Reverse Primer: Y6075_R CTTAGGGAAGCCACTTTCTTATTG
Reviews

Customers who bought this product also purchased
Y6076
Y6076
L550
L550
Y17420
Y17420
Y17696
Y17696
Z16974
Z16974
Z16980
Z16980
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies