Top » Catalog » SNPs » P298

$18.00

P298
[P298]

P298
hg38 Position: ChrY:19459678..19459678
Ancestral: C
Derived: T
Reference: Karafet et al. (Univ. of Arizona)
ISOGG Haplogroup: N1a1a1a1
Comments: Below L839.
Forward Primer: P298_F CTAGTAATGCCTGGGGCTTG
Reverse Primer: P298_R ACAGGTGGGTCACTTTACGG
Reviews

Customers who bought this product also purchased
L395
L395
Z1936
Z1936
N Superclade Panel
N Superclade Panel
Y32731
Y32731
Y28536
Y28536
CTS10760
CTS10760
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies