Top » Catalog » SNPs » P298

$18.00

P298
[P298]

P298
hg38 Position: ChrY:19459678..19459678
Ancestral: C
Derived: T
Reference: Karafet et al. (Univ. of Arizona)
ISOGG Haplogroup: N1a1a1a1
Comments: Below L839.
Forward Primer: P298_F CTAGTAATGCCTGGGGCTTG
Reverse Primer: P298_R ACAGGTGGGTCACTTTACGG
Reviews

Customers who bought this product also purchased
Y87014
Y87014
Y24076
Y24076
A17625
A17625
L1027
L1027
Z16974
Z16974
BY21928
BY21928
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies