Top » Catalog » SNPs » A6458

$18.00

A6458
[A6458]

A6458
hg38 Position: ChrY:14901489..14901489
Ancestral: T
Derived: G
Reference: Alex Williamson (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream DF27 > YP4295
Forward Primer: A6458_F TCCTAATGATTCTAATACTTCTAGTATATGAGATC
Reverse Primer: A6458_R GAATGCTGCCTGCAATTG
Reviews

Customers who bought this product also purchased
Wish a SNP
Wish a SNP
FGC23071
FGC23071
Y5058
Y5058
Y17098
Y17098
Z296
Z296
S6218
S6218
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies