Top » Catalog » SNPs » BY653

$18.00

BY653
[BY653]

BY653
hg38 Position: ChrY:14146957..14146957
Ancestral: A
Derived: G
Reference: FTDNA (2015)
ISOGG Haplogroup: R1b1a2a1a2a
Comments: DF27+ Z195-
Forward Primer: BY653_F TCTTGGTCTGAAGTTAGCTGGG
Reverse Primer: BY653_R GTGTAGACTCTACAATCAATGAGAACG
Reviews

Customers who bought this product also purchased
FT37828
FT37828
DF96
DF96
Y17224
Y17224
S1249
S1249
Y111390
Y111390
Z301
Z301
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies