Top » Catalog » SNPs » BY653

$18.00

BY653
[BY653]

BY653
hg38 Position: ChrY:14146957..14146957
Ancestral: A
Derived: G
Reference: FTDNA (2015)
ISOGG Haplogroup: R1b1a2a1a2a
Comments: DF27+ Z195-
Forward Primer: BY653_F TCTTGGTCTGAAGTTAGCTGGG
Reverse Primer: BY653_R GTGTAGACTCTACAATCAATGAGAACG
Reviews

Customers who bought this product also purchased
BY96801
BY96801
BY27833
BY27833
Y138237
Y138237
L238
L238
FGC17114
FGC17114
M9
M9
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies