Top » Catalog » SNPs » BY653

$18.00

BY653
[BY653]

BY653
hg38 Position: ChrY:14146957..14146957
Ancestral: A
Derived: G
Reference: FTDNA (2015)
ISOGG Haplogroup: R1b1a2a1a2a
Comments: DF27+ Z195-
Forward Primer: BY653_F TCTTGGTCTGAAGTTAGCTGGG
Reverse Primer: BY653_R GTGTAGACTCTACAATCAATGAGAACG
Reviews

Customers who bought this product also purchased
BY21078
BY21078
FT118655
FT118655
BY195245
BY195245
Y83573
Y83573
BY187703
BY187703
A11619
A11619
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies