Top » Catalog » SNPs » BY653

$18.00

BY653
[BY653]

BY653
hg38 Position: ChrY:14146957..14146957
Ancestral: A
Derived: G
Reference: FTDNA (2015)
ISOGG Haplogroup: R1b1a2a1a2a
Comments: DF27+ Z195-
Forward Primer: BY653_F TCTTGGTCTGAAGTTAGCTGGG
Reverse Primer: BY653_R GTGTAGACTCTACAATCAATGAGAACG
Reviews

Customers who bought this product also purchased
BY20173
BY20173
Z301
Z301
BY41289
BY41289
FGC22213
FGC22213
BY21438
BY21438
L48
L48
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies