Top » Catalog » SNPs » BY653

$18.00

BY653
[BY653]

BY653
hg38 Position: ChrY:14146957..14146957
Ancestral: A
Derived: G
Reference: FTDNA (2015)
ISOGG Haplogroup: R1b1a2a1a2a
Comments: DF27+ Z195-
Forward Primer: BY653_F TCTTGGTCTGAAGTTAGCTGGG
Reverse Primer: BY653_R GTGTAGACTCTACAATCAATGAGAACG
Reviews

Customers who bought this product also purchased
BY21078
BY21078
Y24801
Y24801
BY34760
BY34760
BY30356
BY30356
Y134960
Y134960
Y32298
Y32298
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies