Top » Catalog » SNPs » Z38456

$18.00

Z38456
[Z38456]

Z38456
hg38 Position: ChrY:7077403..7077403
Ancestral: G
Derived: A
Reference: Steve Fix (2015)
ISOGG Haplogroup: E1b (not listed)
Comments: Below V13 > Z5016 > Z17107
Forward Primer: Z38456_F TTAGTATTTCCGAAGGAAAATGTTG
Reverse Primer: Z38456_R CTCTTTCATTGCTTCCTCAGG
Reviews

Customers who bought this product also purchased
SK888
SK888
BY4455
BY4455
Y161798
Y161798
Y161799
Y161799
Y97307
Y97307
BY4600
BY4600
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies