Top » Catalog » SNPs » Z7954

$18.00

Z7954
[Z7954]

Z7954
hg38 Position: ChrY:12834841..12834841
Ancestral: G
Derived: A
Reference: Y DNA community
ISOGG Haplogroup: G2a1a1a1a1b1
Comments: Aka FGC1049; found in a G-L293 person
Forward Primer: Z7954_F CTGGTAATTCAGATGCGCC
Reverse Primer: Z7954_R AAACAAAACAACCCCCAATG
Reviews

Customers who bought this product also purchased
FGC1041
FGC1041
Z7952
Z7952
A6095
A6095
Z7940
Z7940
Z7955
Z7955
Z7953
Z7953
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies