Top » Catalog » SNPs » S21607

$18.00

S21607
[S21607]

S21607
hg38 Position: ChrY:16887045..16887045
Ancestral: A
Derived: G
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a1a2a1a1c2b3a1a
Comments: .
Forward Primer: S21607_F GACTTCTCTGGAGGGCTGTG
Reverse Primer: S21607_R CCAGAAATTTGTGCCCTATG
Reviews

Customers who bought this product also purchased
R1b-S21607 Panel
R1b-S21607 Panel
A765
A765
A769
A769
A763
A763
A768
A768
A762
A762
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies