Top » Catalog » SNPs » S21607

$18.00

S21607
[S21607]

S21607
hg38 Position: ChrY:16887045..16887045
Ancestral: A
Derived: G
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a1a2a1a1c2b3a1a
Comments: .
Forward Primer: S21607_F GACTTCTCTGGAGGGCTGTG
Reverse Primer: S21607_R CCAGAAATTTGTGCCCTATG
Reviews

Customers who bought this product also purchased
A769
A769
A763
A763
A768
A768
A762
A762
A767
A767
FGC35194
FGC35194
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies